View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14841_low_21 (Length: 328)
Name: NF14841_low_21
Description: NF14841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14841_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 19 - 311
Target Start/End: Original strand, 33402421 - 33402713
Alignment:
| Q |
19 |
ctaacacaacatgttttctcgtattttcaatgacacagcgcgggaaacacccgttaccattgaagacaattcttggaattttgagttcatcgatgatgtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402421 |
ctaacacaacatgttttctcgtattttcaatgacacagcgcgggaaacacccgttaccattgaagacaattcttggaattttgagttcatcgatgatgtc |
33402520 |
T |
 |
| Q |
119 |
gccagcccaacgatgaaacatgtcaacaactataccgtccggtctgtgttggactaggaactgtttcagaggttcaagcagaatcgaggtatcaatcatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
33402521 |
gccagcccaacgatgaaacatgtcaacaactataccgtccggtctgtgttggactaggaactgtttcagaggttcaaggagaatcgaggtatcgatcatg |
33402620 |
T |
 |
| Q |
219 |
ggaccagaagacatgtcggtgtcggttacttcagtgttttcaggggtggtgagaatctgaatggtgatgggatgattggatttttggtctctg |
311 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402621 |
ggaccagcagacatgtcggtgtcagttacttcagtgttttcaggggtggtgagaatctgaatggtgatgggatgattggatttttggtctctg |
33402713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University