View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14842_high_1 (Length: 262)
Name: NF14842_high_1
Description: NF14842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14842_high_1 |
 | |
|
| [»] chr4 (5 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 262
Target Start/End: Original strand, 29476470 - 29476725
Alignment:
| Q |
7 |
tattgaaatgatgagaggttcaaaaagagggatgcatcttgtgtgggaagatttgagtgttgtaattccaaactttgggaatggacatacgagaagattg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
29476470 |
tattgaaatgatgagaggttcaaaaagagggatgcatcttgtgtgggaagatttgagtgttgtaattccaaactttggcaatggacatacaagaagattg |
29476569 |
T |
|
| Q |
107 |
cttaatggtttgaatggatatgttgaaccaaacagaatcatggctattatgggtccatctggttctggaaaatctactcttcttgatgctttggcaggtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29476570 |
cttaatggtttgaatggatatgttgaaccaaacagaatcatggctattatgggtccatctggttctggaaaatctactcttcttgatgctttggcaggtt |
29476669 |
T |
|
| Q |
207 |
tgttttacttcctaccccatgaaaatcacaagtcatgaaaaatatctcttgcattc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29476670 |
tgttttacttcctaccccatgaaaatcacaagtcatgaaaaatatctcttgcattc |
29476725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 147 - 206
Target Start/End: Original strand, 37290237 - 37290296
Alignment:
| Q |
147 |
tggctattatgggtccatctggttctggaaaatctactcttcttgatgctttggcaggtt |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
37290237 |
tggctattatgggtccatctggctctggaaaatccacacttcttgatgctttagcaggtt |
37290296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 147 - 205
Target Start/End: Complemental strand, 37348000 - 37347942
Alignment:
| Q |
147 |
tggctattatgggtccatctggttctggaaaatctactcttcttgatgctttggcaggt |
205 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
37348000 |
tggctattatgggtccttctggttgtggaaaatctacacttcttgatgctttagcaggt |
37347942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 29426167 - 29426220
Alignment:
| Q |
140 |
agaatcatggctattatgggtccatctggttctggaaaatctactcttcttgat |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| ||| | |||||| |
|
|
| T |
29426167 |
agaatcatggctattatgggtccttctggctctggaaaatccactttgcttgat |
29426220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 29461434 - 29461487
Alignment:
| Q |
140 |
agaatcatggctattatgggtccatctggttctggaaaatctactcttcttgat |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||| ||| | |||||| |
|
|
| T |
29461434 |
agaatcatggctattatgggtccttctggctctggaaaatccactttgcttgat |
29461487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 24614695 - 24614653
Alignment:
| Q |
153 |
ttatgggtccatctggttctggaaaatctactcttcttgatgc |
195 |
Q |
| |
|
||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
24614695 |
ttatgggaccttctggttctggaaaatcaactcttcttgatgc |
24614653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University