View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14842_low_4 (Length: 234)
Name: NF14842_low_4
Description: NF14842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14842_low_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 234
Target Start/End: Original strand, 4412861 - 4413081
Alignment:
| Q |
14 |
atatcatgtacacaagcactattattagattgttagtttgtcaccacgtgaccgtgctcaatatcgtccacgatgcttcttgctgattaaatattactga |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
4412861 |
atatcatgtacacatgcactattattagattgttagtttgtcaccacgtgaccgtgctcaatatcgtccacgctgcttcttgctgattaaatgttactga |
4412960 |
T |
 |
| Q |
114 |
tacaatagtcttcatcaacaacaacnnnnnnntatcaatactatagtactatttatgtatatatcaatgtatgcgttgttccttttcaattttacgaaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412961 |
tacaatagtcttcatcaacaacaacaaaaaaatatcaatactatagtactatttatgtatatatcaatgtatgcgttgttccttttcaattttacgaaaa |
4413060 |
T |
 |
| Q |
214 |
gaaacaaaaccaatttatttc |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4413061 |
gaaacaaaaccaatttatttc |
4413081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University