View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14843_high_11 (Length: 214)
Name: NF14843_high_11
Description: NF14843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14843_high_11 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 7097417 - 7097204
Alignment:
| Q |
1 |
tatgaatatacatggttgatccaaagtttcaaataatggtagcaatcatatttatattgtggagaactgctgtcaaatgtggcttatgtgaccgtattac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7097417 |
tatggatatacatggttgatccaaagtttcaaatcatggtagcaatcatatttatattgtggagaactgctgtcaaatgtggcttatgtgaccgtattac |
7097318 |
T |
|
| Q |
101 |
ggttgcagccactcagaaaactagatgctgcagccaagattcaatcgccgaaattttnnnnnnnnntcttgtttgcttgcgagtgcttagtagaactagt |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
7097317 |
ggttgcagaaactcagaaaactagatgctgcagccaagattcaatcgccgaaatttaaaaaaaaaatcttgtttgcttgtgagtgcttagtagaactagt |
7097218 |
T |
|
| Q |
201 |
aaaaatttattgat |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7097217 |
aaaaatttattgat |
7097204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 80
Target Start/End: Original strand, 32491925 - 32491954
Alignment:
| Q |
51 |
tttatattgtggagaactgctgtcaaatgt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32491925 |
tttatattgtggagaactgctgtcaaatgt |
32491954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University