View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14843_high_6 (Length: 251)
Name: NF14843_high_6
Description: NF14843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14843_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 68 - 204
Target Start/End: Original strand, 52671106 - 52671241
Alignment:
| Q |
68 |
gtacttcaatcttcttt--atagttttgcttcagttttacttggaagaagagatatcatatgtaaaacaaaattaaaaaagtagagaagattatactagt |
165 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52671106 |
gtacttcaatcttcttttaagagttttgcatcagttttacttggaagaagagatatcatatgtaaaacaaaattaaaaaagtagagaagatta---tagt |
52671202 |
T |
 |
| Q |
166 |
tgacaacattatgtaaagcataataatggtaataatatg |
204 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52671203 |
tggcaacattatgtaaagcataataatggtaataatatg |
52671241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University