View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14843_low_10 (Length: 256)
Name: NF14843_low_10
Description: NF14843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14843_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 49074320 - 49074551
Alignment:
| Q |
13 |
tagaacaagtaagaacatcttaaatatttataggttaaagagcaaagcaagaaacacttcaaaatattgagcatcgttcaaatctgttacattagaaaag |
112 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49074320 |
tagaacaagaaagatcatcttaaatatttataggttaaagagcaaagcaagaaacacttcaaaatattgagcatcgttcaaatctgttacattagaaaag |
49074419 |
T |
 |
| Q |
113 |
tattcaaaagagttgttcattgtcacatactttctttcaaaaaattacatacttgtattgaatgataaattgtattatcatttttatgagtaaaatatgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49074420 |
tattcaaaagagttgttcattgtcacatactttctttcaaaaaattacatacttgtattgaatgataaattgtattatcatttttatgagtaaaatatgt |
49074519 |
T |
 |
| Q |
213 |
acacaaacaactaagtatttgatttatcaatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49074520 |
acacaaacaactaagtatttgatttatcaatg |
49074551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University