View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14843_low_14 (Length: 226)
Name: NF14843_low_14
Description: NF14843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14843_low_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 71 - 226
Target Start/End: Complemental strand, 49074911 - 49074756
Alignment:
| Q |
71 |
agaaaatcatgagaaaagaatgtttgaatgatgataaattttaaaatgttttcctttttcttctttgaaagagagttatttaaatagaacgtcaagtaaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49074911 |
agaaaatcatgagaaaagaatgtttgaatgatgataaattttaaaatgttttcctttttcttctttgaaagagagttatttaaatagaacgttaagtaaa |
49074812 |
T |
 |
| Q |
171 |
gagaaacatggatagagataaagacatgttgagttttatactgatttatctccaaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49074811 |
gagaaacatggatagagataaagacacgttgagttttatactgatttatctccaaa |
49074756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University