View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14843_low_16 (Length: 214)

Name: NF14843_low_16
Description: NF14843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14843_low_16
NF14843_low_16
[»] chr1 (2 HSPs)
chr1 (1-214)||(7097204-7097417)
chr1 (51-80)||(32491925-32491954)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 7097417 - 7097204
Alignment:
1 tatgaatatacatggttgatccaaagtttcaaataatggtagcaatcatatttatattgtggagaactgctgtcaaatgtggcttatgtgaccgtattac 100  Q
    |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7097417 tatggatatacatggttgatccaaagtttcaaatcatggtagcaatcatatttatattgtggagaactgctgtcaaatgtggcttatgtgaccgtattac 7097318  T
101 ggttgcagccactcagaaaactagatgctgcagccaagattcaatcgccgaaattttnnnnnnnnntcttgtttgcttgcgagtgcttagtagaactagt 200  Q
    ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||| ||||||||||||||||||||    
7097317 ggttgcagaaactcagaaaactagatgctgcagccaagattcaatcgccgaaatttaaaaaaaaaatcttgtttgcttgtgagtgcttagtagaactagt 7097218  T
201 aaaaatttattgat 214  Q
    ||||||||||||||    
7097217 aaaaatttattgat 7097204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 80
Target Start/End: Original strand, 32491925 - 32491954
Alignment:
51 tttatattgtggagaactgctgtcaaatgt 80  Q
    ||||||||||||||||||||||||||||||    
32491925 tttatattgtggagaactgctgtcaaatgt 32491954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University