View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14843_low_3 (Length: 473)
Name: NF14843_low_3
Description: NF14843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14843_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 312 - 456
Target Start/End: Original strand, 39947417 - 39947561
Alignment:
| Q |
312 |
gctaattaatggaagttctaaatcttttgaatcagacaagggaaaaacttggattcaagctatgcacagcttatttatcagtgacatactttgatcagtt |
411 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39947417 |
gctaattaatgaaagtttataatcttttgaatcagacaagggaaaaacttggattcaagctatgcacagcttatttatcagtgacatactttgatcagtt |
39947516 |
T |
 |
| Q |
412 |
tcttttgaagcaacacatacacatccatgtaactatgtcccttca |
456 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39947517 |
tcttttgaagcaacacatacacatccatgtaactatgtcccttca |
39947561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 167 - 260
Target Start/End: Original strand, 39947269 - 39947362
Alignment:
| Q |
167 |
tgaaaaaacagaatctatgtccttcaattattgctccaactcaaccataggccttgtccatttcaacaacatacgtgttaatgccattgaccac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39947269 |
tgaaaaaacagaatctatgtccttcaattattgctccaactcaaccataggccttgtccatttcaacaacatacgtgttaatgccattgaccac |
39947362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University