View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14844_high_14 (Length: 205)
Name: NF14844_high_14
Description: NF14844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14844_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 27 - 190
Target Start/End: Original strand, 51899206 - 51899369
Alignment:
| Q |
27 |
ctctgactgtgactaatgttgaaattgaaaaaggtctctttctctttatgttttgattgattcatgatggatctgtaatcagtttccatgtgtttcactg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51899206 |
ctctgactgtgactaatgttgaaattgaaaaaggtctctttctctttatgttttgattgattcatgatggatctgtaatcagtttccatgtttttcactg |
51899305 |
T |
 |
| Q |
127 |
ttttagaattttaatgaggccagtctgatattaataactttagtgttagactttttcccctatg |
190 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51899306 |
ttttagaattttcatgaggccagtctgatattaataactttagtgttagactttttcccctatg |
51899369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University