View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14844_high_6 (Length: 315)
Name: NF14844_high_6
Description: NF14844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14844_high_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 315
Target Start/End: Original strand, 44883154 - 44883468
Alignment:
| Q |
1 |
tttgtggtattagtggcatagttgaagctacgacatttgtgtcagataaattggattgtaaagccatgttgtatggttgtgtcgatccatgtccaattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44883154 |
tttgtggtattagtggcatagttgaagctacgacatttgtgtcagataaattggattgtaaagccatgttgtatggttgtgtcgatccatgtccaattgg |
44883253 |
T |
|
| Q |
101 |
cattacataaacaggatactgatgaagttggtgtgattgtgatgttggggcataaactgggtagtaggatgacattggaacttgacctgtacctatagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44883254 |
cattacataaacaggatactgatgaagttggtgtgattgtgatggtggggcataaactgggtagtaggatgacaatggaacttgacctgtacctatagga |
44883353 |
T |
|
| Q |
201 |
cgatgaatatagacaaattgatgttgttgatatgtctgagtttggtggttttgattcaattggtgttgaggtggggagtaaccaagatcctctgcttgtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||| ||||||| |||| ||||||||| |||||||| |
|
|
| T |
44883354 |
cgatgaatatagacaaattgatgttgttgatatgtctgaggttgctggttttgattcaattgttgttggggtggggtgtaatcaagatcctttgcttgtt |
44883453 |
T |
|
| Q |
301 |
ccccttgttgatttt |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44883454 |
ccccttgttgatttt |
44883468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University