View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14844_low_11 (Length: 249)
Name: NF14844_low_11
Description: NF14844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14844_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 41 - 243
Target Start/End: Complemental strand, 49589893 - 49589693
Alignment:
| Q |
41 |
ttgtcacaaatggttatcaatatatcaatgctcttctcccaatattgagatcaaatttctattaacttataacacgtacaactaaaagaaaaataatact |
140 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49589893 |
ttgtcacaaatagttatcaatatatcactactcttctcccaatattgagatcaaatttctattaacttataacacgtacaactaaaagaaaaataatact |
49589794 |
T |
 |
| Q |
141 |
tttatagaaattgtaacatatatatactttcgcttttataccaccgagttcactttctcatcagtactcactaatttgatctcactttcactaatctcct |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49589793 |
tttatagaaattgtaac--gtatatactttcgcttttataccactgagttcactttctcatcagtactcactaatttgatctcactttcactaatctcct |
49589696 |
T |
 |
| Q |
241 |
atg |
243 |
Q |
| |
|
||| |
|
|
| T |
49589695 |
atg |
49589693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University