View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14844_low_14 (Length: 227)
Name: NF14844_low_14
Description: NF14844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14844_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 36482269 - 36482487
Alignment:
| Q |
1 |
ccgacgaagtaccccttaattttccaccaactccaattgtggactgattggaannnnnnnnnncttccatacaagag----ttgatgaacggctactagc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| | ||||||||||||||||||| |
|
|
| T |
36482269 |
ccgacgaagtaccccttaattttccaccaactccaattgtggacagattgaaattttttt----ttccatactaattcattttgatgaacggctactagc |
36482364 |
T |
|
| Q |
97 |
ttaagaaacttgattatgttttttaattctagtatgcatcaattgtgtacaatatttccatatagtgctctttattgtgttaaaattattaatgaaaaaa |
196 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36482365 |
ttaagaaacttggtcatgttttttaattctagtatgcatcaattgtgtacaatatttccatatagtgctctttat--tattaaaattattaatgaaaaaa |
36482462 |
T |
|
| Q |
197 |
tgaatttagaagaccatcatatata |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36482463 |
tgaatttagaagaccatcatatata |
36482487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University