View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14844_low_16 (Length: 205)

Name: NF14844_low_16
Description: NF14844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14844_low_16
NF14844_low_16
[»] chr4 (1 HSPs)
chr4 (27-190)||(51899206-51899369)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 27 - 190
Target Start/End: Original strand, 51899206 - 51899369
Alignment:
27 ctctgactgtgactaatgttgaaattgaaaaaggtctctttctctttatgttttgattgattcatgatggatctgtaatcagtttccatgtgtttcactg 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
51899206 ctctgactgtgactaatgttgaaattgaaaaaggtctctttctctttatgttttgattgattcatgatggatctgtaatcagtttccatgtttttcactg 51899305  T
127 ttttagaattttaatgaggccagtctgatattaataactttagtgttagactttttcccctatg 190  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
51899306 ttttagaattttcatgaggccagtctgatattaataactttagtgttagactttttcccctatg 51899369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University