View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14846_high_5 (Length: 241)
Name: NF14846_high_5
Description: NF14846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14846_high_5 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 67 - 241
Target Start/End: Complemental strand, 894838 - 894664
Alignment:
| Q |
67 |
gagaaggaaagccagcaagacaaggaagagatggttgtttgggggaatcaatcataacaaattaattcgaagatggtgctaattaagttgaatattgtgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894838 |
gagaaggaaagccagcaagacaaggaagagatggttgtttgggggaatcaatcataacaaattaattcgaagatggtgctaattaagttgaatattgtgt |
894739 |
T |
 |
| Q |
167 |
cgcagacgtatgatcatctatacatataaataaaggcaaaataacttattttagttggtagggatattgcatatt |
241 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894738 |
cgcagacgcatgatcatctgtacctataaataaaggcaaaataacttattttagttggtagggatattgcatatt |
894664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 211 - 241
Target Start/End: Original strand, 5944434 - 5944464
Alignment:
| Q |
211 |
cttattttagttggtagggatattgcatatt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5944434 |
cttattttagttggtagggatattgcatatt |
5944464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 95 - 206
Target Start/End: Original strand, 5526 - 5637
Alignment:
| Q |
95 |
agatggttgtttgggggaatcaatcataacaaattaattcgaagatggtgctaattaagttgaatattgtgtcgcagacgtatgatcatctatacatata |
194 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||| |||||||||| || |||||||||||||| |||| |
|
|
| T |
5526 |
agatggttgtttgggggaatcgatcataacaaattaatacgaagatggtcctaattaagttgaatactgtgtcgcagccgcatgatcatctatacttata |
5625 |
T |
 |
| Q |
195 |
aataaaggcaaa |
206 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5626 |
aataaaggcaaa |
5637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University