View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14847_high_4 (Length: 392)
Name: NF14847_high_4
Description: NF14847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14847_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 19 - 380
Target Start/End: Original strand, 21584926 - 21585287
Alignment:
| Q |
19 |
ttttgtgcatagttcaaacaggtcaaatcaaatctagttgatgctaggttacttggatgataggatcattgtgttaaaacctataattgaaacgaagtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21584926 |
ttttgtgcatagttcaaacaggtcaaatcaaatctagttgatgctaggttacttggatgataggatcattgtgttaaaacctataattgaaacgaagtat |
21585025 |
T |
|
| Q |
119 |
gtagacaccccaaacaaatggtacaattgtgagaatattttaaaggttacactgaggtggtgtgtgtgaatcatttcatgtctgtgtctattctatatgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21585026 |
gtagacaccccaaacaaatggtacaattgtgagaatattttaaaggttacactgaggtggtgtgtgtgaatcatttcatgtctgtgtctattctatatgg |
21585125 |
T |
|
| Q |
219 |
gtcttctcttataatgctttgtttgtaagggtggactcactttataagttgctgagagatgtgttccatttgcaaataaaaatgattgtttattgtccat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21585126 |
gtcttctcttataatgctttgtttgtaagggtggactcactttataagttgctgagagatgtgttccatttgcaaataaaaatgattgtttattgtccat |
21585225 |
T |
|
| Q |
319 |
gtcgtgtagaatcatgacatgtttggcaataagtattattttgtttatcccttaacagaaca |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21585226 |
gtcgtgtagaatcatgacatgtttggcaataagtattattttgtttatcccttaacagaaca |
21585287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University