View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14847_high_9 (Length: 266)
Name: NF14847_high_9
Description: NF14847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14847_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 43117875 - 43117687
Alignment:
| Q |
18 |
gttgcttagggcgtgcttcaggtcttcaattattctctgcaacatatatatgatacaacatgatatccacaagcttgacttcagaatacatgcagatgac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43117875 |
gttgcttagggcgtgcttcaggtcttcaattattctctgcaacatat----gatacaacatgatatccacaagcttgacttcagaatacatgcagatgac |
43117780 |
T |
|
| Q |
118 |
aatgaaactataacaatctctgatattggcataatattgtcggttgatgctaaagggtatgagggaataactaactcttctgccattttctgtgaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||| |
|
|
| T |
43117779 |
aatgaaactataacaatctctgatattggcataacaatgtcggttgatgctaaagggtatgagtgaa----taactcttctgccattttttgtgaaa |
43117687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University