View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14847_low_15 (Length: 304)
Name: NF14847_low_15
Description: NF14847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14847_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 36 - 285
Target Start/End: Complemental strand, 30524310 - 30524069
Alignment:
| Q |
36 |
cttcaaagagcctagcagcgaaactcgcgcatacttagtttgatgagaaatagggaattgcgggttcaaccctgcaccccatgatatcaaatgtccctgc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
30524310 |
cttcaaagagcctagcagcgaaactcgcgcataattagtatgatgagaaatagggaattacgggttcaaccctgca--------tatcaaatgtccctgc |
30524219 |
T |
 |
| Q |
136 |
aactatttatcatctgagttgtacttacatactagattagctcattaagtgatatttatactaattattattgttgattttgtttttgaattataggtat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30524218 |
aactatttatcatctgagttgtacttacagactagattagctcattaagtgatatatatactaattattattgttgattttgtttttgaattataggtat |
30524119 |
T |
 |
| Q |
236 |
ggtgctatgttcaagtctcacattttaggttgtccttgtgtgatgatttc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30524118 |
ggtgctatgttcaagtctcacattttaggttgtccttgtgtgatgatttc |
30524069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 229 - 285
Target Start/End: Original strand, 10422864 - 10422920
Alignment:
| Q |
229 |
taggtatggtgctatgttcaagtctcacattttaggttgtccttgtgtgatgatttc |
285 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
10422864 |
taggtatggttctatgttcaagtctcacattttgggatgtccatgtgtgatgatttc |
10422920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 90 - 163
Target Start/End: Original strand, 40094662 - 40094735
Alignment:
| Q |
90 |
gaattgcgggttcaaccctgcaccccatgatatcaaatgtccctgcaactatttatcatctgagttgtacttac |
163 |
Q |
| |
|
|||||| |||||||| ||||| ||| ||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
40094662 |
gaattgtgggttcaaacctgcgttccaacatatcaaatgtccctgcaaaattttaccatctgagttgtacttac |
40094735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University