View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14847_low_19 (Length: 241)
Name: NF14847_low_19
Description: NF14847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14847_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 22625330 - 22625129
Alignment:
| Q |
19 |
gttgttttatgcaattgaaattaatatctaagttttgtcattagaatattctcnnnnnnnnnnnnnnnntagggttgtattgaattgaattgaattgaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
22625330 |
gttgttttatgcaattgaaattaatatctaagttttgtcattagaatattctctatattatatatatattggggttgtat----------tgaattgaat |
22625241 |
T |
|
| Q |
119 |
ctgtgatttattgcaggagaattaaatcaaacaaacaaaaaatgtcatctagtttttatgatatgaatttgagatcaggtggtgcagatctggccactgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22625240 |
ctgtgatttattgcaggagaattaaatcaaacaaacaaaaaatgtcatctagtttgtatgatatgaatttgagatcaggtggtgcagatctggccactgc |
22625141 |
T |
|
| Q |
219 |
tattgtaccttt |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22625140 |
tattgtaccttt |
22625129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University