View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14849_high_11 (Length: 286)
Name: NF14849_high_11
Description: NF14849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14849_high_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 39090176 - 39090461
Alignment:
| Q |
1 |
taaacaatttgggtcggctctaaatgcagcccgtcaagcggatgctactgttctagtgatgggattggatcagtcaattgaggctgaaatggtagatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090176 |
taaacaatttgggtcggctctaaatgcagcccgtcaagcggatgctactgttctagtgatgggattggatcagtcaattgaggctgaaatggtagatagg |
39090275 |
T |
|
| Q |
101 |
actggtttacttcttcctggacatcaacaagaccttgtttcaaaggtagcggctgcctcgagaggcccaaccattttggtcttaatgtctggtggtccta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39090276 |
actggtttacttcttcctggacatcaacaagaccttgtttcaaaggtagcggctgcctcgagaggcccaaccattttggtcttaatgtctggtgggccta |
39090375 |
T |
|
| Q |
201 |
tagatataacttttgcaaagaatgatcctcgaattataggcatcttgtgggctggttatcctggtcaagccggtggtgctgccatt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090376 |
tagatataacttttgcaaagaatgatcctcgaattatgggcattttgtgggctggttatcctggtcaagccggtggtgctgccatt |
39090461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 24 - 282
Target Start/End: Complemental strand, 44715220 - 44714962
Alignment:
| Q |
24 |
atgcagcccgtcaagcggatgctactgttctagtgatgggattggatcagtcaattgaggctgaaatggtagataggactggtttacttcttcctggaca |
123 |
Q |
| |
|
||||||| ||||| || ||||| ||| || ||||||| || ||||| || || ||||| ||||||| || ||||||||| | || ||| | |||||||| |
|
|
| T |
44715220 |
atgcagctcgtcatgcagatgcaactattttagtgataggcttggaccaatccattgaagctgaaactgttgataggactagcttgcttttgcctggaca |
44715121 |
T |
|
| Q |
124 |
tcaacaagaccttgtttcaaaggtagcggctgcctcgagaggcccaaccattttggtcttaatgtctggtggtcctatagatataacttttgcaaagaat |
223 |
Q |
| |
|
||||||||| |||||||||||||| || ||||| || | || ||||| |||||||| || ||||||||||| ||| | || || ||||||||||||||| |
|
|
| T |
44715120 |
tcaacaagatcttgtttcaaaggtggcagctgcatcaaagggaccaactattttggttttgatgtctggtgggcctgtggacattacttttgcaaagaat |
44715021 |
T |
|
| Q |
224 |
gatcctcgaattataggcatcttgtgggctggttatcctggtcaagccggtggtgctgc |
282 |
Q |
| |
|
|| || | || ||||| |||||||| |||||||| || ||||| ||||||||||| |
|
|
| T |
44715020 |
gaccccaaagttgctggcatattgtgggcgggttatccaggccaagctggtggtgctgc |
44714962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University