View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484R-Insertion-10 (Length: 336)
Name: NF1484R-Insertion-10
Description: NF1484R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484R-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 8 - 336
Target Start/End: Complemental strand, 38841285 - 38840957
Alignment:
| Q |
8 |
aaaaataacggaagttcttcgtgcatgtgacgcagtacctacatgtggtctctgtttaagcaacaatgttaatgtttgggttagaaacattgatagcagc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841285 |
aaaaataacggaagttcttcgtgcatgtgacgcagtacctacatgtggtctctgtttaagcaacaatgttaatgtttgggttagaaacattgatagcagc |
38841186 |
T |
|
| Q |
108 |
aatgttgctaccctcttcgcatcaattatttggtgttggaaataacatggtactacttgagacacaagatggttacaacatatttttactacatgataat |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841185 |
aatgttgctaccctcttcgcgtcaattatttggtgttggaaataacatggtactacttgagacacaagatggttacaacatatttttactacatgataat |
38841086 |
T |
|
| Q |
208 |
gctagcaaaatgatttacaacatatttataacatgttaagttgtgcttctacatgtattaaaacatttcagaaattggtttttagaaagaaattactatt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38841085 |
gctagcaaaatgatttacaacatatttataacatgttaagttgtgcttctacatgtattaaaacattttagaaattggtttttagaaagaaattactatt |
38840986 |
T |
|
| Q |
308 |
tcaatttagtttttggagtctcggttggg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38840985 |
tcaatttagtttttggagtctcggttggg |
38840957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University