View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484R-Insertion-5 (Length: 171)
Name: NF1484R-Insertion-5
Description: NF1484R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484R-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 170
Target Start/End: Original strand, 25738954 - 25739115
Alignment:
| Q |
9 |
ggaatcctgtagaattctgagtgtgctgggagtcttttttggaagttattttgaaagaaatgagaatcacatggtgattcaagattatcttggctatttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25738954 |
ggaatcctgtagaattctgagtgtgctgggagtcttttttggaagttattttgaaagaaatgagaatcacatggtgattcaagattatcttggctatttg |
25739053 |
T |
|
| Q |
109 |
gttgaaggatggcagtgttgaaaaacctatgtgattgcattggtggaatctatgaattacgg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25739054 |
gttgaaggatggcagtgttgaaaaacctatgtgattgcattggtggaatctatgaattacgg |
25739115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University