View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484R-Insertion-6 (Length: 209)
Name: NF1484R-Insertion-6
Description: NF1484R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484R-Insertion-6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 32145748 - 32145547
Alignment:
| Q |
9 |
gttaaaacctctaccattcaattcccactgc-ccactctgatttcatcagctgacctagttatagacatcaattcgttgagatgagtgagattgcatact |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
32145748 |
gttaaaacctctaccattcaattcccgttgcgccactctgatttcatcagctgacctagttatagacatcaattcgttgagatgagtgagactccatact |
32145649 |
T |
|
| Q |
108 |
ccttctatcacatggtcatcattctctgaggttcattgtgaatcctcatgctacgatccaatgaaataaccttacactcttttccgcttcctaaaagcgc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
32145648 |
ccttctatcacatggtcatcattctctgaggttcattgtgaatcctcgtgctacgatccaatgaaacaaccttacactcctttccgcttcctaaaagcgc |
32145549 |
T |
|
| Q |
208 |
ta |
209 |
Q |
| |
|
|| |
|
|
| T |
32145548 |
ta |
32145547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University