View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_high_44 (Length: 295)
Name: NF1484_high_44
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 95 - 277
Target Start/End: Complemental strand, 40820269 - 40820087
Alignment:
| Q |
95 |
tatacagatagaaacttctattgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc |
194 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820269 |
tatacagatagaaacttctgttgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc |
40820170 |
T |
 |
| Q |
195 |
ccaccagattcaacttccaccatggaggtgtccttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatatt |
277 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820169 |
ccaccagattcaacctccaccatggaggtgttcttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatatt |
40820087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 40820350 - 40820312
Alignment:
| Q |
14 |
cataggtcattaactcgtttctatatcttaggagttagg |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40820350 |
cataggtcattaactcgtttctatctcttaggagttagg |
40820312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University