View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_high_51 (Length: 251)
Name: NF1484_high_51
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_high_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 50781133 - 50781309
Alignment:
| Q |
15 |
tctcaagaacgacaatgatgtgagagtcgtgttctttatatttggacaatatagtttaaagggaccaattgagttagacgctttcttggccagatctttt |
114 |
Q |
| |
|
|||||||||| || |||||||||||||| ||||||||| ||||||||||||||||| ||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
50781133 |
tctcaagaacaacgatgatgtgagagtcatgttctttacatttggacaatatagttcaaagggatcgattgagttacacgctttcttggccagatctttt |
50781232 |
T |
|
| Q |
115 |
cattcagtaaagtttgattcggctcaggtcctatgacaaaatcaagtcttccatggataaactatatgaagaattca |
191 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50781233 |
tattcaataaagtttgattcggcccaggtcctatgacaaaatcaagtcttccatggataaactataggaagaattca |
50781309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 102
Target Start/End: Original strand, 55398889 - 55398947
Alignment:
| Q |
44 |
tgttctttatatttggacaatatagtttaaagggaccaattgagttagacgctttcttg |
102 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||| ||| ||||| ||| |||| |
|
|
| T |
55398889 |
tgttctttatatttggtcagtacagtttaaagggaccaatcgagctagacacttccttg |
55398947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7798 times since January 2019
Visitors: 1245