View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_high_64 (Length: 240)
Name: NF1484_high_64
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 32145541 - 32145748
Alignment:
| Q |
15 |
caaaggtagcgcttttaggaagcggaaaagagtgtaaggttatttcattggatcgtagcatgaggattcacaatgaacctcagagaatgatgaccatgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32145541 |
caaaggtagcgcttttaggaagcggaaaggagtgtaaggttgtttcattggatcgtagcacgaggattcacaatgaacctcagagaatgatgaccatgtg |
32145640 |
T |
 |
| Q |
115 |
atagaaggagtatgcaatctcactcatctcaacgaattgatgtctataactaggtcagctgatgaaatcagagtgg-gcagtgggaattgaatggtagag |
213 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32145641 |
atagaaggagtatggagtctcactcatctcaacgaattgatgtctataactaggtcagctgatgaaatcagagtggcgcaacgggaattgaatggtagag |
32145740 |
T |
 |
| Q |
214 |
gttttaac |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
32145741 |
gttttaac |
32145748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University