View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_high_72 (Length: 236)
Name: NF1484_high_72
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_high_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 40655737 - 40655956
Alignment:
| Q |
1 |
ttgagcagccctcaagatacataactaaattttaccctacatctgatcttctctcctcctcaaagattctaatagactaaaataatcctaaattttgcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40655737 |
ttgagcagccctcaagatacataactaaattttatcccagatctaatcttctcacctcctcaaagattctaatagactaaaataatcctaaattttgtac |
40655836 |
T |
 |
| Q |
101 |
ttcttatatacaatttactttttagttaatgcacttaacattatgtcaactaaannnnnnnncgaaaaaatataaaacccaacggaacatatcattatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40655837 |
ttcttatatacaatttactttttagttaatgcacttaacattatgtcaactaaattttttttcgaaaaaatgtaaaacccaacggaacatatcattatgc |
40655936 |
T |
 |
| Q |
201 |
ctctttgttcagtttatata |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40655937 |
ctctttgttcagtttatata |
40655956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University