View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_high_80 (Length: 209)
Name: NF1484_high_80
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_high_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 4109498 - 4109323
Alignment:
| Q |
20 |
atgaagacagcaggagagcggttacggaggacggaagcaagatcatcgtcatcgtcagacgacaaagaggcgatctcgttgtcgtctaattcgatgacgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109498 |
atgaagacagcaggagagcggttacggaggacggaagcaagatcatcgtcatcgtcagacgacaaagaggcgatctcgttgtcgtctaattcgatgacgg |
4109399 |
T |
|
| Q |
120 |
tgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagcaagaggaacgtgtgaagatgat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4109398 |
tgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagcaagaggaacgtgtgaagatgat |
4109323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 180
Target Start/End: Original strand, 48154041 - 48154130
Alignment:
| Q |
91 |
gatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagcaagagga |
180 |
Q |
| |
|
|||||||||||| || |||| ||| |||||||||| ||| || |||||| |||| || ||| |||||||||| ||||||||||| ||||| |
|
|
| T |
48154041 |
gatctcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgagga |
48154130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University