View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1484_high_80 (Length: 209)

Name: NF1484_high_80
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1484_high_80
NF1484_high_80
[»] chr1 (1 HSPs)
chr1 (20-195)||(4109323-4109498)
[»] chr3 (1 HSPs)
chr3 (91-180)||(48154041-48154130)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 4109498 - 4109323
Alignment:
20 atgaagacagcaggagagcggttacggaggacggaagcaagatcatcgtcatcgtcagacgacaaagaggcgatctcgttgtcgtctaattcgatgacgg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4109498 atgaagacagcaggagagcggttacggaggacggaagcaagatcatcgtcatcgtcagacgacaaagaggcgatctcgttgtcgtctaattcgatgacgg 4109399  T
120 tgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagcaagaggaacgtgtgaagatgat 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4109398 tgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagcaagaggaacgtgtgaagatgat 4109323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 180
Target Start/End: Original strand, 48154041 - 48154130
Alignment:
91 gatctcgttgtcgtctaattcgatgacggtgggattaacacctatggtggagagaagcttcttcatgacatgacacatgcagcaagagga 180  Q
    |||||||||||| || |||| ||| |||||||||| ||| || |||||| |||| || ||| |||||||||| ||||||||||| |||||    
48154041 gatctcgttgtcatccaattggataacggtgggatgaacgccgatggtgaagaggagattcctcatgacatggcacatgcagcatgagga 48154130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University