View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_21 (Length: 401)
Name: NF1484_low_21
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 23 - 374
Target Start/End: Complemental strand, 39385713 - 39385377
Alignment:
| Q |
23 |
gagtatattaaaatataactgatacaatagcttcatattttaaaagatgcaataaaaatccagcaaataaaatggaattgccacgctttttagtcgtgtg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39385713 |
gagtatattaaaatataactgatacaatagcttcatatgttaaaagatgcaataaaaatccagcaaataaaatggaattgccacgctttttagtcatgtg |
39385614 |
T |
|
| Q |
123 |
tgtctatnnnnnnnnnnnnttaaataaatgttgtttcattcacatttttctctaattggacttcatgttattgtcttcgcaaatgattgatggtagtagt |
222 |
Q |
| |
|
||||||| | |||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39385613 |
tgtctatacacac--------acttaaaggttatttcattcacatttttctcgaattggacttcatgttattgtcttcgcaaatgattgatggtagtagt |
39385522 |
T |
|
| Q |
223 |
annnnnnngtatgtaaccactaatttaattgaccatctttgataaactctctcctcttcttaaccatttcttcatatgtaatacacacaccccgttctgc |
322 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39385521 |
acttttttgtatgtaaccactaatttaattgaccatctttgataaactctctcc---tcttaaccatttcttcatatgtaat----acaccccgttctgc |
39385429 |
T |
|
| Q |
323 |
tattgcttgatgttgatataaataatgacaccaagcaagcattgctgcattg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39385428 |
tattgcttgatgttgatataaataatgacaccaagcaagaattgctgcattg |
39385377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University