View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_34 (Length: 361)
Name: NF1484_low_34
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 17 - 348
Target Start/End: Complemental strand, 38841285 - 38840954
Alignment:
| Q |
17 |
aaaaataacggaagttcttcgtgcatgtgacgcagtacctacatgtggtctctgtttaagcaacaatgttaatgtttgggttagaaacattgatagcagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841285 |
aaaaataacggaagttcttcgtgcatgtgacgcagtacctacatgtggtctctgtttaagcaacaatgttaatgtttgggttagaaacattgatagcagc |
38841186 |
T |
 |
| Q |
117 |
aatgttgctaccctcttcgcatcaattatttggtgttggaaataacatggtactacttgagacacaagatggttacaacatatttttactacatgataat |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841185 |
aatgttgctaccctcttcgcgtcaattatttggtgttggaaataacatggtactacttgagacacaagatggttacaacatatttttactacatgataat |
38841086 |
T |
 |
| Q |
217 |
gctagcaaaatgatttacaacatatttataacatgttaagttgtgcttctacatgtattaaaacatttcagaaattggtttttagaaagaaattactatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38841085 |
gctagcaaaatgatttacaacatatttataacatgttaagttgtgcttctacatgtattaaaacattttagaaattggtttttagaaagaaattactatt |
38840986 |
T |
 |
| Q |
317 |
tcaatttagtttttggagtctcggttgggcct |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38840985 |
tcaatttagtttttggagtctcggttgggcct |
38840954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University