View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_5 (Length: 567)
Name: NF1484_low_5
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 2e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 86 - 279
Target Start/End: Complemental strand, 42679501 - 42679306
Alignment:
| Q |
86 |
acatttgatcaagggacgctatatagtcggtggctgtacatattcctgaagcagaaaatatcgcgtgttactatcccgatata--aattcataaagatgt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42679501 |
acatttgatcaagggacgctatatagtcggtggctgtacatattcctgaagcagaaaatatcgcgtgttactatcccgatatataaattcataaagatgt |
42679402 |
T |
 |
| Q |
184 |
gttcaagacctattggtgttgctggacatattattcctaggaatttcccatcactaacgcgtaggtggtaaggttaaagaaaatcgtgttcgttag |
279 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42679401 |
gttcaaaacctattggtgttgctggacatattattcctaggaatttcccatcactaatgcttaggtggtaaggttaaagaaaatcgcgttcgttag |
42679306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 3 - 65
Target Start/End: Complemental strand, 42679581 - 42679519
Alignment:
| Q |
3 |
tcgagagagaagaaagaattgtatagaatgtatnnnnnnnngttgttgcgtgaaaggttatag |
65 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
42679581 |
tcgagaaagaagaaagaattgtatagaatgtataaaaaaaagtggttgcgtgaaaggttatag |
42679519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University