View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_53 (Length: 267)
Name: NF1484_low_53
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 11056849 - 11057016
Alignment:
| Q |
17 |
tccattgaatacatggtgtgtgtaagatgaatccttccttttattttaaatatatttgactcttgaaaatttaactttgcaacgaatacatcaatagcga |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
11056849 |
tccattgaatacatg---tgtgtaagatgaatccttctttttattttaaatatatttgacacttgaaaatttaactttgcaac-aatacatcaatagtga |
11056944 |
T |
|
| Q |
117 |
ggaactcattaatcagttctaagaaaaacttacaatttttaactttttatgctatgtaagtttgcacatgat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11056945 |
ggaactcattaatcagttctaagaaaaacttacaatttttatctttttatgctatgcaagtttgcacatgat |
11057016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 188
Target Start/End: Complemental strand, 42456974 - 42456919
Alignment:
| Q |
133 |
ttctaagaaaaacttacaatttttaactttttatgctatgtaagtttgcacatgat |
188 |
Q |
| |
|
|||||| | |||||||| ||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
42456974 |
ttctaatataaacttactatttttaacttcttatactatgtaagtttgcgcatgat |
42456919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University