View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_61 (Length: 249)
Name: NF1484_low_61
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1484_low_61 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 56353509 - 56353274
Alignment:
Q |
1 |
accgtcggaagcactgaattacgttgctaggtgaagcaataagtggtgtgatgtaactctaatctaatctatttagatatcaatataatattagtgtgtt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56353509 |
accgtcggaagcactgaattacgttgctaggtgaagcaataagtggtgtgatgtaactcaaatctaatctatttagatatcaatataatattagtgtgtt |
56353410 |
T |
|
Q |
101 |
tggtaaattggggagcacggtatcactgcacaatccattaactttgtgatattctacttcagtgttgaaacattattaggacgcgagaaaacaaagataa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56353409 |
tggtaaattggggagcacggtatcactgcacaatccattaactttgtgatattctacttcagtgttgaaacattattaggacgcgagaaaacaaagataa |
56353310 |
T |
|
Q |
201 |
catgcatccaaacacgtagttaataagttggcattc |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
56353309 |
catgcatccaaacacgtagttaataagttggcattc |
56353274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4721 times since January 2019
Visitors: 5911