View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_67 (Length: 241)
Name: NF1484_low_67
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 100 - 231
Target Start/End: Complemental strand, 8428736 - 8428605
Alignment:
| Q |
100 |
cacatttcactgcatgcaaggaatgcgttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgctttgaa |
199 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8428736 |
cacatttcactcaatgcaaggaatgcgttagttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgctttcaa |
8428637 |
T |
 |
| Q |
200 |
aaattgtcactatgcaattaggtagcctacaa |
231 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
8428636 |
aaattgtcactatgcaattagctagcctacaa |
8428605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 100 - 231
Target Start/End: Original strand, 8450701 - 8450832
Alignment:
| Q |
100 |
cacatttcactgcatgcaaggaatgcgttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgctttgaa |
199 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8450701 |
cacatttcactcaatgcaaggaatgcgttagttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgctttcaa |
8450800 |
T |
 |
| Q |
200 |
aaattgtcactatgcaattaggtagcctacaa |
231 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
8450801 |
aaattgtcactatgcaattagctagcctacaa |
8450832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 121 - 196
Target Start/End: Original strand, 8349695 - 8349770
Alignment:
| Q |
121 |
aatgcgttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgcttt |
196 |
Q |
| |
|
|||| ||| ||||||||| |||||||||||| | |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
8349695 |
aatgtgtttgttttatagatcagtcactctctacatttcacaaagtttccgatgtgggacttctttcttttgcttt |
8349770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 125 - 236
Target Start/End: Original strand, 8437047 - 8437156
Alignment:
| Q |
125 |
cgttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgctttgaaaaattgtcactatgcaattaggtag |
224 |
Q |
| |
|
|||| ||||||||||||| ||||||||| ||||||||| |||| ||||||||||| ||||||||||||||| | |||||||||||| ||||| ||| |
|
|
| T |
8437047 |
cgttagttttatagctcactcactctcatcatttcacaacgtttccgatgtgggacttctttcttttgcttt--catattgtcactatgatattagctag |
8437144 |
T |
 |
| Q |
225 |
cctacaagtata |
236 |
Q |
| |
|
| ||||| |||| |
|
|
| T |
8437145 |
cttacaattata |
8437156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 126 - 237
Target Start/End: Original strand, 8447543 - 8447652
Alignment:
| Q |
126 |
gttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgctttgaaaaattgtcactatgcaattaggtagc |
225 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||| | | ||||||||||| ||||||||||||||| ||||| ||||||| ||| | |||| |
|
|
| T |
8447543 |
gttggttttatagctcactcactctcatcatttcacaaattatccgatgtgggacttctttcttttgcttt--caaattatcactatcatattggctagc |
8447640 |
T |
 |
| Q |
226 |
ctacaagtatag |
237 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8447641 |
ctacaagtatag |
8447652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 196
Target Start/End: Complemental strand, 8481426 - 8481351
Alignment:
| Q |
121 |
aatgcgttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttttgcttt |
196 |
Q |
| |
|
|||| ||| ||||||||| |||||||||||| | |||||| ||||||| |||||||| || ||||||||||||||| |
|
|
| T |
8481426 |
aatgtgtttgttttatagatcagtcactctctacatttcataaagtttccgatgtggaacttctttcttttgcttt |
8481351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 191
Target Start/End: Original strand, 8357990 - 8358054
Alignment:
| Q |
127 |
ttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttctttt |
191 |
Q |
| |
|
|||||||||||||||| ||| |||| | |||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
8357990 |
ttggttttatagctcactcaatctctacatttcacaaagtttccaatgtgggacttctttctttt |
8358054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 122 - 189
Target Start/End: Original strand, 8408601 - 8408668
Alignment:
| Q |
122 |
atgcgttggttttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttctt |
189 |
Q |
| |
|
||||| ||||||||||||||| ||||||| | |||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
8408601 |
atgcgctggttttatagctcattcactctgtacatttcaaaaagtttccgatgtgggacttctttctt |
8408668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 8353397 - 8353455
Alignment:
| Q |
132 |
tttatagctcagtcactctcaatatttcacaaagttttcgatgtgggacgtctttcttt |
190 |
Q |
| |
|
|||||| |||| ||| |||| ||||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
8353397 |
tttataactcactcaatctctatatttcacaaagtttttgatatgggacttctttcttt |
8353455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University