View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_72 (Length: 237)
Name: NF1484_low_72
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1484_low_72 |
![](./plan/images/spacer.gif) | ![NF1484_low_72](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 49162687 - 49162485
Alignment:
Q |
19 |
ttccttagtttttccatgtattattgaattgcatgtaagttgtagaaggtaaaaggtaataaaaatacaaatgaatatatatggtgtcacatacggcatc |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
49162687 |
ttccttagtttttccatgtattattgaattgcatgtaagttgtaaaaggtaaaaagtaataaaaatacaaataaatatatatggtgtcacatacggcatc |
49162588 |
T |
![](./plan/images/spacer.gif) |
Q |
119 |
tcnnnnnnnattttcaaataactactaatttttcaaggtatacaacatgattgtgtcatcatatgataatttagcggtggaggatatttgttggacacca |
218 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
49162587 |
tctttttttattttcaaataactactaatttttcaaggtatacagcatgattgtgtcgtcatatgctaatttagcggtggaggatatttgttggacacca |
49162488 |
T |
![](./plan/images/spacer.gif) |
Q |
219 |
cca |
221 |
Q |
|
|
||| |
|
|
T |
49162487 |
cca |
49162485 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 31642 times since January 2019
Visitors: 1224