View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_85 (Length: 216)
Name: NF1484_low_85
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 25 - 200
Target Start/End: Complemental strand, 38531692 - 38531522
Alignment:
| Q |
25 |
catgtcgaagaatatcgaacgtaaattaaatcaagctgaattaaatgaatgaacagtttttaaactttaaaacattatacttatgaaccacctctctcnn |
124 |
Q |
| |
|
||||||||| ||| ||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||| |||||||| ||||||| | |
|
|
| T |
38531692 |
catgtcgaaaaatgtcgaacgtaaattaactcaagctgaattaaattaatgaacagttttcaaactttaaaacattaaacttatgagtcacctcttt--- |
38531596 |
T |
|
| Q |
125 |
nnnnnnnnnnaatatttaaactattcttttttaatgtaaggctaaactactcatatgcttgatggaagttttactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38531595 |
--ttttttttaatatttaaactattcttttttaatgtgcggctaaactactcatatgcttgatggaagttttactt |
38531522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University