View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1484_low_89 (Length: 203)
Name: NF1484_low_89
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1484_low_89 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 7353042 - 7353210
Alignment:
| Q |
17 |
aaggccaatggaagtaacagtaacaatggaaacaataaggatggtaggtgggctgagcagttgctcaacccttgtgctgtagccataaccggtggaaatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353042 |
aaggccaatggaagtaacagtaacaatggaaacaataaggatggtaggtgggctgagcagttgctcaacccttgtgctgtagccataaccggtggaaatc |
7353141 |
T |
|
| Q |
117 |
tgaatcgtgtgcaacatctcttatatgttctccatgagctagcctcaactaccggtgatgccaaccacc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353142 |
tgaatcgtgtgcaacatctcttatatgttctccatgagctagcctcaactaccggtgatgccaaccacc |
7353210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8719 times since January 2019
Visitors: 6045