View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14851_low_5 (Length: 310)
Name: NF14851_low_5
Description: NF14851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14851_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 40 - 299
Target Start/End: Complemental strand, 34034084 - 34033825
Alignment:
| Q |
40 |
catgcaatgatcattcatttggagttcaacacgaggataatgaatacaagacaaacttcaaaagctctcctcaaggattctcaaaattagtctcatcccc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34034084 |
catgcaatgatcattcatttggagttcaacacgaggataatgaatacaagacaaacttcaaaagctctcctcaaggattctcaaaattagtctcatcccc |
34033985 |
T |
 |
| Q |
140 |
ggcaactactagtctcggatctgattcatctcaaggcgccaaagtatttgccgatgactgtgagctaaattccccatctgagtctaaatgttcagtttat |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033984 |
ggcaactactagtcttggatctgattcatatcaaggcgccaaagtatttgccgatgactgtgagctaaattccccatctgagtctaaatgttcagtttat |
34033885 |
T |
 |
| Q |
240 |
gatcatgtgctttcagaacaaattacagaacaggatgatgatggggaaagtgatgatgat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033884 |
gatcatgtgctttcagaacaaattacagaacaggatgatgatggggaaagtgatgatgat |
34033825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University