View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14853_high_14 (Length: 252)
Name: NF14853_high_14
Description: NF14853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14853_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 7046827 - 7047050
Alignment:
| Q |
19 |
aagattttggcggtgaaaatgaacttggacggaaaattggggaacgaacaggacgagagctagatccacgtggcacgtccgcgattggctagattgtttt |
118 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
7046827 |
aagattttggggttgagaatgaacttggacggaaaattggggaacgaacaggacgagagctagatccacgtggcacgtccgcaattggctcgattgtttt |
7046926 |
T |
|
| Q |
119 |
tctagaagacttgcaaacaagcccaaaaggacccgtaattgctttctatactccaatgcatttatttttaccccccatcttttgaaactttgataaaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
7046927 |
tctagaagacttgcaaacaagcccaaaaggacccgtaattgctttctatactccaatgcatttattttta-cccccatc-tttgaaactttgataaaaat |
7047024 |
T |
|
| Q |
219 |
gattttgaatgtttatgttagttcat |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7047025 |
gattttgaatgtttatgttagttcat |
7047050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University