View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14853_low_13 (Length: 304)

Name: NF14853_low_13
Description: NF14853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14853_low_13
NF14853_low_13
[»] chr5 (1 HSPs)
chr5 (31-134)||(18037018-18037121)
[»] chr1 (1 HSPs)
chr1 (165-280)||(31958031-31958145)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 31 - 134
Target Start/End: Original strand, 18037018 - 18037121
Alignment:
31 aaatttgaatgtgtaaaattcacttttcagttaaaattgtgatccttcatatttgtttatgtgttttcttattatcatcggtacaaatgggaaaatgaac 130  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||    
18037018 aaatttgaatgtgtaaaattcacttttcagttaaaatagtgatccttcatatttgtttatgtgttttcttattatcatcgatacaaatgggaaaaggaac 18037117  T
131 aaag 134  Q
    ||||    
18037118 aaag 18037121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 280
Target Start/End: Complemental strand, 31958145 - 31958031
Alignment:
165 tcccactagcatcagctagcagttggaggagaattccattcggaggcaacgcaatagaccaaaacgcgtcgtgattgccatctccaaacttagcaatata 264  Q
    |||||||||||||  ||||||| |||||||||||| |||   || ||  ||| || |||||||||||||| ||| ||||| |||||| ||||||||||||    
31958145 tcccactagcatcgcctagcaggtggaggagaattgcatcttgatgctccgcgat-gaccaaaacgcgtcttgactgccagctccaagcttagcaatata 31958047  T
265 atatgcacaaacattt 280  Q
    || |||||||| ||||    
31958046 atctgcacaaatattt 31958031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University