View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14853_low_7 (Length: 365)
Name: NF14853_low_7
Description: NF14853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14853_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 231 - 349
Target Start/End: Original strand, 48229782 - 48229900
Alignment:
| Q |
231 |
tctcgaacagcttgcgcatttgtgggggccaaaagagcaacgatgtcaaaggattggagggtttatgttttattgagaatcacaagatgtgttggtaaca |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48229782 |
tctcgaacagcttgcgcatttgtgggggccaaaagagcaacgatgtcaaaggattggagggtttatgttttattgagaatcacaagatgtgttggtaaca |
48229881 |
T |
 |
| Q |
331 |
atgaataaacgagtctatt |
349 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
48229882 |
atgaataaacgagtctatt |
48229900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 48229550 - 48229713
Alignment:
| Q |
1 |
caaggcaaacagaatcattaatgattttgctnnnnnnn-tgtaggaaaaatgatcttcaattttattattttgcgcgctctcaaagttacaagacagcca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48229550 |
caaggcaaacagaatcattaatgattttgctaaaaaaaatgtaggaaaaatgatcttcaattttattattttgcgcgctctcaaagttacaagacagcca |
48229649 |
T |
 |
| Q |
100 |
tgagtaggatatatcagagcatgattgttgc-nnnnnnnnggactctatttgctctttatcttg |
162 |
Q |
| |
|
|||||||||||||| | |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48229650 |
tgagtaggatatatgaaagcatgattgttgctttttttttggactctatttgctctttatcttg |
48229713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University