View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14854_high_16 (Length: 403)
Name: NF14854_high_16
Description: NF14854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14854_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 384
Target Start/End: Complemental strand, 6942905 - 6942522
Alignment:
| Q |
1 |
gtatgcaatctcgtcgttcccaactctcccctttcaacgtgtcatcgtttccaatgcgacggcgttttcatgcaaagcgaaagctacaaactccataaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6942905 |
gtatgcaatctcgtcgttcccaactctctcctttcaacgtgtcatcgtttccaacgcgacgacattttcatgcaaagcgaaagctacaaactccgtaaca |
6942806 |
T |
 |
| Q |
101 |
gcgtctccatcatccggacgaagggagttgctgtttctcctcacggcgtctactgctttaacgtcaagggaatcggtgtctatggcgcaggatattcctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942805 |
gcgtctccatcatccggacgaagggagatgctgtttctcctcacggcgtctactgctttaacggcaagggaatcggtgtctatggcgcaggatattcctc |
6942706 |
T |
 |
| Q |
201 |
tgtttgggatacgaaagagtctgaagaaagcggaggaaaaggccgaggagattgtgaaggaaggatttgaatcggcggagaaaggattggagacggcgga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942705 |
tgtttgggatacgaaagagtctgaagaaagcggaggaaaaggccgaggagattgtgaaggaaggatttgaatcggcggagaaaggattggagacggcgga |
6942606 |
T |
 |
| Q |
301 |
gaaaggacttgagaaggcggaactaggattggaggaggcggagaaggagatagagacgggggtggggcttgggaatttggcaca |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942605 |
gaaaggacttgagaaggcggaactaggattggaggaggcggagaaggagatagagacgggggtggggcttgggaatttggcaca |
6942522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University