View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14854_high_18 (Length: 396)
Name: NF14854_high_18
Description: NF14854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14854_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 20 - 383
Target Start/End: Original strand, 4152585 - 4152944
Alignment:
| Q |
20 |
cttttttcttcttccattttctatatcacaaaaatgaaaatgccttcttttctaggttctttacctccacgatcattcttcttttgtttcctccttcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4152585 |
cttttttcttcttccattttctatatcacaaaaatgaaaatgccttcttttctaggttctttacctccacgatcattcttcttttgtttcctccttcttc |
4152684 |
T |
|
| Q |
120 |
cacttttgcttttgctattgctcttagtagcaccttcttcttcttcatcttcctctaattatgacaagaaagtaaccatgtcaatctactatgaaagtct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4152685 |
cacttttgcttttgctattgctcttagtagcaccttcttcttcttcatcttcctctaattatgacaagaaagtaaccatgtcaatctactatgaaagtct |
4152784 |
T |
|
| Q |
220 |
atgtcctttttgtgctgattttatagtgaacgatcttgtaaggctcttccaaactggtctcatttccattgtggatcttagaatggttccttggggaaat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4152785 |
atgtcctttttgtgctgattttatagtgaacgatcttgtaaggctcttccaaactggtctcatttccattgtggatcttagaatggttccttggggaaat |
4152884 |
T |
|
| Q |
320 |
gctgggattaaacctgatggcacttttgattgtcaggtatatatatgttttcattttttatatt |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4152885 |
gctgggattaaacctgatggcacttttgattgtcagg----tatatgttttcattttttatatt |
4152944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 23 - 360
Target Start/End: Original strand, 4159795 - 4160125
Alignment:
| Q |
23 |
ttttcttcttccattttctatatcacaaaaatgaaaatgccttcttttctaggttctttacctccacgatcattcttcttttgtttcctccttcttccac |
122 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||||||||||||||||| || |||||||| | | |||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
4159795 |
tttttttcttccatttcc-atagcacaaaaatgaaaatgccttctcttttaggttctattcatccacgctcattcttcttttgtttcatccttcttccaa |
4159893 |
T |
|
| Q |
123 |
ttttgcttttgctattgctcttagtagcaccttcttcttcttcatcttcctctaattatgacaagaaagtaaccatgtcaatctactatgaaagtctatg |
222 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| ||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4159894 |
tttt------gctattgctattagtagcaccttcttcttcatcaacttcctctaaaaatgagaagaaagtaaccatgtcaatctactatgaaagtctatg |
4159987 |
T |
|
| Q |
223 |
tcctttttgtgctgattttatagtgaacgatcttgtaaggctcttccaaactggtctcatttccattgtggatcttagaatggttccttggggaaatgct |
322 |
Q |
| |
|
|||| || ||||||||| ||||||||| ||||||| | |||||| ||||| ||||||||| |||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
4159988 |
cccttattctgctgatttcatagtgaaccatcttgtgaagctctttcaaaccaatctcatttcaattgtgaatcttaaaatggtcccttggggaaatgct |
4160087 |
T |
|
| Q |
323 |
gggattaaacctgatggcacttttgattgtcaggtata |
360 |
Q |
| |
|
||||| | || |||||||||||| |||||||||||| |
|
|
| T |
4160088 |
aggattgcaactaatggcacttttgtttgtcaggtata |
4160125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University