View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14854_high_25 (Length: 287)
Name: NF14854_high_25
Description: NF14854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14854_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 40848551 - 40848821
Alignment:
| Q |
1 |
aaaatatactcttctttcacggtaacgtatctaattagttgaattatttcgtaacttttcatttgcattcgtagatttgcatggtataaatgannnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40848551 |
aaaatatactcttctttcacggtaacgtatctatttagttgaattatttcgtaacttttcatttgcattcgtagatttgcatggtataaatgattttttt |
40848650 |
T |
 |
| Q |
101 |
nnnnnnnngttctggagggacatttgaatcattctcatcattttcttccgttttcttctaaaacactctatagctcatttggtgctttccccttttcccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||| |||||||||| |
|
|
| T |
40848651 |
ttgtttttgttctggagggacatttgaatcattctcatcattttcttccgtttccttctaaaactctctatagctcatttggctgttt-cccttttccca |
40848749 |
T |
 |
| Q |
201 |
gtgttatgtctattaatcataaactgagtgcacctcattcatttattgaatcattgtaaaatagaaaaatgat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40848750 |
ttgttatgtctattaatcataaactgagtgcacctcattca-ttattgaatcattgtaaaatagaaaaatgat |
40848821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 8131940 - 8131902
Alignment:
| Q |
1 |
aaaatatactcttctttcacggtaacgtatctaattagt |
39 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8131940 |
aaaatatactctactttcacggtaacatatctaattagt |
8131902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University