View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14854_high_28 (Length: 252)
Name: NF14854_high_28
Description: NF14854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14854_high_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 6943128 - 6942887
Alignment:
| Q |
11 |
gattattctaaaaacagtcggatttagaaacccaaatccaatgcaaggatccatttaaaaacccggacattttttaggattattttatacacgtgtaggt |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6943128 |
gattattcttaaaacagtcggatttagaaacccaaatccaatgcaaggatccatttaaaaacccggacatttttttggattattttatacacgtgtaggt |
6943029 |
T |
 |
| Q |
111 |
tttataacggttgataaaggaagggtatctaggtaattacaaaacttcgttaaagtttgtaaaagaatgaagaatcagtagccacaaacgaagaggatca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6943028 |
tttataacggttgataaaggaagggtatctaggtaattacaaaacttcgttaaagtttgtaaaagaatgaagaatcagtagccacaaacgaagaggatca |
6942929 |
T |
 |
| Q |
211 |
gagtgtcgtgaagaaatggttgggtatgcaatctcgtcgttc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6942928 |
gagtgtcgtgaagaaatggttgggtatgcaatctcgtcgttc |
6942887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University