View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14854_high_32 (Length: 232)
Name: NF14854_high_32
Description: NF14854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14854_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 45667685 - 45667471
Alignment:
| Q |
1 |
acatgccctaggtaaaagcaggtcagggctctagcccctcctatctatcaagggaaacattttttacatgagtgagtgattctaactaggttgacactac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45667685 |
acatgccctaggtaaaagcaggtcagggctctagcccctcctatctatcaagggaaacattttttacatgagtgagtgattctaactaggttgacactac |
45667586 |
T |
|
| Q |
101 |
aaacactataattaatttacaatcatctatatcacaccattgttattgaactatctggcaccaagatatgtaaaactaaaatatgattggaaacttcaaa |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45667585 |
aaacac--taattaatttacaatcatctatatcacaccattgttattgaactatctggcaccaagatatgtaaaactaaaatatgattggaaacttcaaa |
45667488 |
T |
|
| Q |
201 |
cttgtagtcttgtattt |
217 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
45667487 |
cttttagtcttgtattt |
45667471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University