View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14854_low_28 (Length: 275)
Name: NF14854_low_28
Description: NF14854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14854_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 6612401 - 6612645
Alignment:
| Q |
18 |
gttatgtgataacatgggctttcaaattcattgatcatggatgatatttttgatggaggcttggtttgatcaattggctacgatatgacaatcaaattaa |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
6612401 |
gttatgtgatcacatgggctttcaaattcattgatcatggaatatatttttgatggaggcttggtttgatcaattggctaccatatgaaaatcagattaa |
6612500 |
T |
|
| Q |
118 |
ttagtacatcatgtttgtgattcacgtggctttctttcttgcatccataaattgatatataatggattggtgtggctgcgtctttattttatgctcgnnn |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6612501 |
ttagtacatcaggtttgtgattcacgtggctttctttcttgcatccataaattgatatataatggattggtgtggctgcgtctttattttatgctagaaa |
6612600 |
T |
|
| Q |
218 |
nnnnttt-ctgtccatactatgatcagatcatgtcttgcctatgc |
261 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6612601 |
aaaatttcctgtccatactatgatcagatcatgtcttgcctatgc |
6612645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 22790485 - 22790291
Alignment:
| Q |
18 |
gttatgtgataacatgggctttcaaattcattgatcatggatgatatttttgatggaggcttggtttgatcaattggctacgatatgacaatcaaattaa |
117 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| ||||| ||||||| |||||||||| |||||| ||||||||||||| |||||||| | |||| || |
|
|
| T |
22790485 |
gttatgtgatcatatgggctttcaaattcattgattatggaagatatttctgatggaggcatggtttcatcaattggctaccatatgacatttaaatcaa |
22790386 |
T |
|
| Q |
118 |
ttagtacatcatgtttgtgattcacgtggctttctttcttgcatccataaattgatatataatggattggtgtggctgcgtctttattttatgct |
212 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||||||||||| |||||||| |||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
22790385 |
ttagtacattaggtttgtgattcacgtggctttatttcttgcatccacaaattgatttatagtggtttggtgtggctgcgtcttaattttatgct |
22790291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University