View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14854_low_35 (Length: 239)
Name: NF14854_low_35
Description: NF14854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14854_low_35 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 30781900 - 30782120
Alignment:
| Q |
19 |
atctagggtataggaaacttattccttttagtccttttggattcgcctgccttgaagacttggaattaggtctttgctgatgataggaatgattcaaagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30781900 |
atctagggtataggaaacttattccttttagtccttttggattcgcctgccttgaagactaggaattaggtctttgctgatgataggaatgattcaaagc |
30781999 |
T |
 |
| Q |
119 |
aaagtaaaccgtcccttttcttgcaaccattggtacaataagcgatgttcaaagagagaactttctttgttgttgcttgatcttcttactaggttatgct |
218 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782000 |
aaagtaaacggtcccttctcttgcaaccattggtacaataagcgatgttcaaagagagaattttctttgttgttgcttgatcttcttactaggttatgct |
30782099 |
T |
 |
| Q |
219 |
tcttcatagttctatcttgtt |
239 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
30782100 |
tcttcattgttctatcttgtt |
30782120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University