View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14855_high_4 (Length: 500)
Name: NF14855_high_4
Description: NF14855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14855_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 461; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 461; E-Value: 0
Query Start/End: Original strand, 20 - 488
Target Start/End: Complemental strand, 36423142 - 36422674
Alignment:
| Q |
20 |
gaacattgagtacagcaaccatttcctcaagtgtcattgtagggtatccagaagaacctggccttgtttcatggttggttatttcacttgtgctaagatc |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423142 |
gaacatcgagtacagcaaccatttcctcaagtgtcattgtagggtatccagaagaacctggccttgtttcatggttggttatttcacttgtgctaagatc |
36423043 |
T |
|
| Q |
120 |
aacagtgagagtgtgagtgacacgtttatcaagtgcaaccacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaagttctttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423042 |
aacagtgagagtgtgagtgacacgtttatcaagtgcaaccacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaagttctttg |
36422943 |
T |
|
| Q |
220 |
tctggttcttctagaacaatggaattgagagtgtaactgtttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgttgaattcttgga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422942 |
tctggttcttctagaacaatggaattgagagtgtaactgtttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgttgaattcttgga |
36422843 |
T |
|
| Q |
320 |
tggttagagggtctaaagggtggcgaggttcatcggattcatggtttggttgttgatggcgagtggagaaggatggtttgtggattggatttgaagattg |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422842 |
tggttagagggtctaaagggtggcgaggttcatcggattcatggtttggttgttgacggcgagtggagaaggatggtttgtggattggatttgaagattg |
36422743 |
T |
|
| Q |
420 |
aaaacggttctttgaggtgcaccatccagagaagatgttgcagtctagagcttctttgttgaatgatga |
488 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36422742 |
aaaacggttctttgaggtgcaccatccagagaagatgttgcagtctagagcttctttgttgaatgatga |
36422674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University