View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14855_low_20 (Length: 259)
Name: NF14855_low_20
Description: NF14855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14855_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 28437859 - 28438086
Alignment:
| Q |
17 |
catttgaagcttcagcagcaaagattagcaaccttgtttgaagataataacaggaaagaaagtggaactgttttgctttctcaggttagcattgaaaagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28437859 |
catttgaagcttcagcagcaaagattagcaaccttgtttgaagataataacaggaaagagagtggaactgttttgctttctcaggttagcattgaaaagc |
28437958 |
T |
 |
| Q |
117 |
ctcaacctattttgtttcagaatcttgagatttcaaaggctgagatgtttcaagttggtggtggtggtgattcaagaaaggaaggtgcaagtgaatggtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28437959 |
ctcaacctattttgtttcagaatcttgagatttcaaaggctgagatgtttcaagttggtggtggtggtgattcaagaaaggaaggtgcaagtgaatggtt |
28438058 |
T |
 |
| Q |
217 |
ctttggtatgaattcttattcatctgtg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28438059 |
ctttggtatgaattcttattcatctgtg |
28438086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University